 |
 |
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
 |
|||
|
|||
 |
|||
|
|||
 |
|||
|
IBM Builds ‘Bar Code Reader’ for DNA
- Text size
Jeremy A. Kaplan
Fox News
October 6, 2009
- A d v e r t i s e m e n t
Imagine a diet tailored to the precise speed of a person’s metabolism. Using a little microelectronics, a little physics, and no small dose of biology, IBM has brought that futuristic world a little bit closer.
The DNA Transistor is a project from IBM Research that aims to advance personalized medicine, by making it simpler (and much cheaper) to read an individual’s unique DNA sequence — the special combination of proteins that makes you unlike anyone else.
The technology isn’t finished yet, but its potential is tantalizin enough that IBM wanted to share it with the world. And the company claims researchers are making progress.
-
- Social bookmarks
- Email this article
-
- Print this page
- Share on Twitter
October 6th, 2009 at 2:00 pm
agtuuugugugutuauaugatatgagatatgatuaugugutu
tailgunner Reply:
October 6th, 2009 at 4:54 pm
Imagine a world where vaccines, neurotics and especially medicine can be guaranteed to cause adverse reactions because it’s designed for an individual’s DNA.
realitybloger.wordpress.com
FreedomLover Reply:
October 6th, 2009 at 8:37 pm
My thoughts exactly.
yikes Reply:
October 9th, 2009 at 12:14 am
IBM, isn’t that the same company who allowed the trains to run on time? Or did they help keep track of the protected people?
BobLeeSwagger Reply:
October 6th, 2009 at 7:26 pm
5′TATAGGACAGACAGGATATAGCAGAGAGCAGAGACGATCAGTGACAGTACAGTAGCATAGCTC3′
3′ATATCCTGTCTGTCC TATATCGTCTCTCG TCTCTG CTAGTCACTGTCATGTCATCGTATCGAG5′
WE ARE WATCHING YOU….
Yeah? watch my finger IBM- the middle one is extending to you.
_____________________________
_____________________________
_____________________________
_____________________________
_________________************
_________________************
_________________************
JACKSON AND NO BANK Reply:
October 6th, 2009 at 11:47 pm
ibm made a machine for hitler to keep track of the sheep.
REBEL SON Reply:
October 7th, 2009 at 7:15 am
im suggesting that you guys read the bar code tattoo i was forced to read it last year in school, didnt think anything of it, but what all is happening in the book is sorta what is happening now. not saying to follow the frickin book for advice, it is fiction of course, but in the book, Global 1, a company owns EVERYTHING from cows to banks to crops. the president works for global 1 and they introduce a bar code system and you have to get it tattooed on you at 17, in the end, it has your DNA information and if you have some sort of disorder or illness the tattoo practicaly kills you because you wont be able to buy anything since paper money and credit cards are non-existant. its an interesting book.
King Shit Reply:
October 7th, 2009 at 11:28 am
that is fucked up. Anything else you guys do that is related to this??????
LibertyTreeBud Reply:
October 9th, 2009 at 10:41 am
The bar code is a method of accounting but I think the push for vaccines is because the ‘tag’ or ‘nano-technology’ chip will be in them. Good luck and God bless.
RESISTG.
October 6th, 2009 at 2:06 pm
IBM…isn’t that the same company that made punch cards for Hitler’s Holocaust?
Keith Shelton Reply:
October 6th, 2009 at 2:15 pm
indeed
IBM Sucks Reply:
October 6th, 2009 at 2:32 pm
You ever notice these cats are always wrapped up in some BS like this. they helped Hitler and lord only knows what else, now look at them. they are sickening!
check out much about IBM and their contributions to humanity in these docs
http://www.spywitnessnews.org/.....umentaries
midwestherbalist Reply:
October 6th, 2009 at 4:33 pm
watch this http://www.youtube.com/watch?v=rfevjFskGJA
then google IBM and the Holocaust
osuredleg Reply:
October 7th, 2009 at 11:25 am
You are all correct. Herman Hollerith. My God…I just looked up Hollerith on Google to get the spelling correct, and they have a UPS barcode on the top where the “Google” logo usually sits. this crap is getting ridiculous with Google placing space craft and crop circles, etc. on their site. they are so NWO controlled!
Anyway, getting back to IBM, Hollerith established the company after developing his code (i.e., computer punch cards) for the US Census Bureau. The president of the company before and during WWII was Watson, who had a dubious reputation, and he would sell his mothre out to make money. IBM rented out the tabulating machines to the NAZI government to use for the concentration camps and many other logistics operations. They even had repair personnel co-located at the camps, so they can’t say that they didn’t know what was going on there.
October 6th, 2009 at 2:11 pm
[DON'T TAKE THE MARK]
roaddog6 Reply:
October 6th, 2009 at 6:58 pm
I already have a bar code tatooed on my wrist. Does it count?
roaddog6 Reply:
October 6th, 2009 at 7:00 pm
I already have a bar code tattooed on my wrist. Does that count?
October 6th, 2009 at 2:11 pm
Mark of the beast
October 6th, 2009 at 2:16 pm
Karma sucks !!!
Over The Target Reply:
October 7th, 2009 at 11:22 am
then,
Akarma doesn’t suck !!!
?
http://www.experiencefestival....../id/139801
Sir Baby De Porky Reply:
October 7th, 2009 at 5:33 pm
Akarma doesn’t suck as much as vikarma !!!
P.S. Head is shakin’ profusely !!!
October 6th, 2009 at 2:33 pm
These fucktards can blow me too. All of them can. They are all dead and don’t know it yet.
Sir Baby De Porky Reply:
October 6th, 2009 at 3:31 pm
Not picky…are you !!!
P.S. Not even their bitches with a fifty foot pole !!!
October 6th, 2009 at 2:45 pm
“Imagine a world where…” the government stays out of our business, and IBM is prosecuted for all its Nazi war crimes.
Solar Absoluton Reply:
October 6th, 2009 at 3:08 pm
Indeed, Unfortunately that is a dream world. This world is backwards so to speak.
October 6th, 2009 at 2:46 pm
Who is it?
OWN Reply:
October 6th, 2009 at 3:05 pm
Johnny Cochran
October 6th, 2009 at 3:00 pm
get a life loser. Jews are not as bad as you make them to be. No, I am not a Jew. Racist moron!!!
Andy Reply:
October 9th, 2009 at 3:31 pm
what are you talking about ?
October 6th, 2009 at 4:24 pm
“Imagine a world where medicine is guaranteed not to cause adverse reactions because it’s designed for an individual’s DNA.”
Imagine a world in which bioweapons are guaranteed to kill because they’re designed for an individual’s DNA.
nader paul kucinich gravel Reply:
October 6th, 2009 at 5:13 pm
United States of Israel.
Treasury is Bankrupt.
American Holocaust.
9/11 False Flag.
James Blunt,
No Bravery
October 6th, 2009 at 5:10 pm
imagine a world where the people are robot zombies because ibm will do anything the elite tell them to do.
LaughingBarry Reply:
October 6th, 2009 at 5:54 pm
IBM ARE the elite. Even more than Bush or Obama. IBM are right up there with the Rockefellers themselves.
October 6th, 2009 at 5:28 pm
“individual’s unique DNA sequence — the special combination of proteins that makes you unlike anyone else”
Nice, way to screw up the science right off the bat. DNA is not a “combination of proteins” it is DNA. They are different molecules.
October 6th, 2009 at 5:54 pm
Oh how nice.
So, during Nazi Germany IBM provided punch card amchines to calculate who would be sent to the ovens and gas chambers, and who would be worked to death… I’m so ‘glad’ they got the contract this time around.
Hey New World Order! The answer to 1984 is 1776.
October 6th, 2009 at 5:58 pm
One IBM executive to another: “Gee, think of what we could have done if we’d had this at Auschwitz, eh?”
October 6th, 2009 at 7:28 pm
They dont need no DNA scan on me- they need a BBD to scan my BIG BLACK DICK!!!!
October 6th, 2009 at 9:23 pm
This is a devil at work!
Gary Reply:
October 6th, 2009 at 11:23 pm
It’s a lot of devils at work.
October 6th, 2009 at 9:58 pm
Against NWO communism, against Lisbon Treaty – last chance in Europe – spread it out please: President of Czech Republic Vaclav Klaus needs support ! Thank you all !
http://supportvaclavklaus.wordpress.com/
October 6th, 2009 at 11:16 pm
Hey, rockers. STYX was right.
Domo arigato, Mister Roboto.
October 6th, 2009 at 11:16 pm
CUT THROUGH THE DAMN MATRIX!!!!!!!!!!!!!!!!!
October 6th, 2009 at 11:36 pm
Are you people retarded??
A DNA reader would be a HUGE help in the pharmaceutical sciences. I tell you ’cause I’m studying pharmacy at college and alergic reactions as well as other interactions are the biggest PITA of drug design (specially mollecular simulations). It would be awesome to have some sort of database in which we could look out what’s the specific gene that repeats more and more on the population and what protein expresses so we can specifically avoid interactions with that protein and get to the spot where the drug is ought to act….all of that BEFORE even trying with animals!!!
People won’t have to risk themselves again for unsecure vaccines or drugs ’cause they will be designed to be even less invasive than they’re already are.
Josh F. Reply:
October 7th, 2009 at 12:10 am
Have you ever seen Gattaca?
Take a lesson.
Suprsleep1 Reply:
October 7th, 2009 at 1:37 am
Giving up freedoms for securiy never works….you get permitted test subjects. That means people that WILLINGLY allow you to do this. You DONT mandate it on the masses……its not your right.
roaddog6 Reply:
October 7th, 2009 at 7:51 am
google has a bar code up this morning on their home page.
Over The Target Reply:
October 7th, 2009 at 11:28 am
CyberMiguel if the people are ‘retarted’ as you question
Don’t worry, the ‘pharmaceutical sciences’ will fix everything, huh ?
All hail the ‘pharmaceutical sciences’
Life can’t exist without ‘pharmaceutical sciences’, when I grow up I want a job in ‘pharmaceutical sciences’…
We would all be apes throwing crap at each other if it weren’t for the …’pharmaceutical sciences’
I’ll just accept that blindly. Great idea.
Anti Vigilante Reply:
October 7th, 2009 at 5:57 pm
put away the pamphlet and read the fine print
yellowhak1 Reply:
October 7th, 2009 at 8:00 pm
CYBER MIGUEL i suggest you read up on vaccine ingredients their adverse reactions and who told me. should be posted on the cute tickle me elmo story. by the way, if you think this is for “our” or “your” benefit you are seriously deluded!
October 7th, 2009 at 8:28 am
“The technology isn’t finished yet”
and… seeing that we’ve been studying DNA for, 15-20 years, and have extrapolated less then 1% worth of its data… will it ever be?
October 7th, 2009 at 11:18 am
I noticed that too roaddog6, I wonder what thats all about..
roaddog6 Reply:
October 7th, 2009 at 11:47 am
?
October 7th, 2009 at 11:21 am
It says the usual Goolge logo has been replaced by the ubiquitous black-and-white bar code design to celebrate the 57th anniversary of the first bar code patent.
Oh boy! :/
roaddog6 Reply:
October 7th, 2009 at 11:48 am
oh.
October 7th, 2009 at 11:28 am
Has anyone seen the barcode in lieu of the Google logo today?! What the f**k is going on? This freaked me out when I was looking something up at the same time reading about the IBM DNA barcode reader. Is this a sign?
ernest Reply:
October 7th, 2009 at 4:32 pm
You see, it’s better to set Google advanced search page as your search page
and you see no more these shit images
October 7th, 2009 at 11:33 am
Long live FATHER! Long live INGSOC!
October 7th, 2009 at 4:30 pm
IBM is very well known for it’s good work for fascists. Good work for german nazis was the first big step of IBM on it’s long way to become the biggest technological supporter for the system of opression.
October 7th, 2009 at 7:58 pm
An airtight ID system will be necessary to the BEAST. A barcode on your forehead or hand cross-referenced with your iris or fingerprint scan (respectively) then cross-referenced with your DNA scan sounds like it. For the sake of your soul, DO NOT EVER TAKE THE MARK NO MATTER WHAT!
October 8th, 2009 at 1:06 pm
I think you should do some research on this ‘Bar Code Reader’ for DNA and the relationship to the Hollerinth tabulator they used for the Holocaust
October 8th, 2009 at 3:05 pm
INDEED
BASTARD
MACHINES
October 8th, 2009 at 3:36 pm
CHEMTRAILS SUCK:
http://www.youtube.com/watch?v=lovRlVSQhbA
October 9th, 2009 at 3:03 am
Al this spook science has got to come to an end.
For the economy to recover America should set free and assist it free energy scientists
and protect against monopoly in this next economic energy evolution.
October 10th, 2009 at 11:58 am
It’s the same dance, folks.
Technology this time instead of ideology. Our one hope, imo, is the human spirit of resistance to threats to its existence. At some point the sea of mankind [ as in all our brothers and sisters ] will turn in tide, ripping the veils away from the creatures hiding in the shadows of such concepts as national security and divine right.
All to provide a secure position to rule in malice for psychopathic greed and to repress our knowledge of this process.
What ever we do, it must be in brotherhood with love.
Our struggle must be uncompromising and relentless.